From LISTSERV@LISTSERV.UIC.EDU Thu Jul 12 20:20:35 2001 Date: Mon, 9 Jul 2001 07:39:51 -0500 From: "L-Soft list server at UIC (1.8d)" To: Laura Quilter Subject: File: "FEMINISTSF-LIT LOG0002A" ========================================================================= Date: Tue, 1 Feb 2000 09:45:28 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Suzanne Feldman Subject: Re: Jane Yolen MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Hi folks-- Nancy Phillips wrote: > concerning myth as background vs. myth-making: > > Mythmaking, or religion-making, seems to be a fairly common event in > feminist SFF, with the insight that myth (and certainly religion!) can be > an artifact with political content. > > Any other suggestions of books/authors exploring intersection of > religion/myth and gender? Not to blow my own horn or anything, but this is exactly what my latest novel, The Annunciate is about. I took 'western white male' christianisty, stripped it down to its matriarchal roots, framed it with the ultimate in supply and demand capitalism, and....well, you'll have to read it to see how the alien innocent becomes the Holy Mother. yours, Suze Feldman (Severna Park) > > ========================================================================= Date: Tue, 1 Feb 2000 09:58:38 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Emily Patrick Subject: Re: Jane Yolen MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Suzanne, > Not to blow my own horn or anything, but this is exactly what my latest novel, > The Annunciate is about. I took 'western white male' christianisty, stripped it > down to its matriarchal roots, framed it with the ultimate in supply and demand > capitalism, and....well, you'll have to read it to see how the alien innocent > becomes the Holy Mother. yours, Hmm... now hearing you put it that way makes me want to go read it again. :-) - emily ========================================================================= Date: Tue, 1 Feb 2000 18:48:10 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Suzanne Feldman Subject: Re: Jane Yolen MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Emily Patrick wrote: > Suzanne, > > > Not to blow my own horn or anything, but this is exactly what my latest > novel, > > The Annunciate is about. I took 'western white male' christianisty, > stripped it > > down to its matriarchal roots, framed it with the ultimate in supply and > demand > > capitalism, and....well, you'll have to read it to see how the alien > innocent > > becomes the Holy Mother. yours, > > Hmm... now hearing you put it that way makes me want to go read it again. > :-) > The book has so much in it, it's hard to reduce it to a couple of sentences. I usually tell people it's about sex, drugs and power relationships. yours, Suze ========================================================================= Date: Wed, 2 Feb 2000 10:17:11 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Pamela Bedore Subject: Gender/Myth Intersections In-Reply-To: <3.0.6.32.20000131223627.00c74c60@POP3.SLU.EDU> MIME-Version: 1.0 Content-Type: TEXT/PLAIN; charset=US-ASCII Thanks, Nancy, for your useful and insightful post on feminist myth in science fiction. > Any other suggestions of books/authors exploring intersection of > religion/myth and gender? > I wonder if we might also consider Sherri Tepper's *The Gate to Women's Country* and Pamela Sargent's *The Shore of Women.* I always forget which of these books is which, since they have a lot in common, and I read them a couple of years ago one after the other. Either way, both deal with women living inside a gated community while men live outside. I believe that both have a goddess figure. Certainly, one of them has a situation whereby the women inside the gated community create a goddess in order to control the men. Both very interesting books that I should definitely read again! And that I would highly recommend. Cheers, pamela bedore department of english university of rochester ========================================================================= Date: Wed, 2 Feb 2000 18:52:22 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Nancy Phillips Subject: Re: Gender/Myth Intersections MIME-version: 1.0 Content-type: text/plain; charset="us-ascii" Both Sherri Tepper's *The Gate to Women's Country* and Pamela Sargent's *The Shore of Women* are post-nuclear holocaust Earth novels, as are many SF of female-dominant societies. Tepper's Gate seemed to have myth and ritual but no deistic religion. Women enacted a rewritten Iphigenia in Aulis, emphasising the futility of total war and the cost to women (and mocking male warriors as clowns with large fake penises, a la classical comedy). Men saluted the phallus and had other rites of passage to manhood, to warriorhood, after death in glorious battle. Noone yearned for transcendence. Although the Iphigenia myth is Greek in origin and the men's rituals and social organisation are generic Bronze Age, the only recognisable religion lies outside the society, in a group of polygamists resembling the most brutal stereotype of the early Mormons. The ruling women supported the men's warrior society as a place to put the "culls", and kept the men that could not fit into warrior society as nominal household servants in the women's community, with real roles as "secret" husbands and political advisors. The ruling women's manipulations of men lay in the control of reproduction, by enabling non-ruling women to have sex with the glamorous warriors, but inseminating these women with "superior" sperm of the household servants. The goal was to breed peaceable men capable of cooperating with women. Sargent's Shore had a very explicit Goddess religion for the men, in which the Goddess was represented by telepathic transmissions by senior (ruling) women to the primitive tribal men that come to shrines containing headsets carrying the transmissions. The men live for recognition by the Goddess, because they are called thereby to the outer wall of the settlement for exceedingly erotic telepathic visitations (with sperm collection) and for collection of young boys who are adopted into the tribe as "sons", gifts of the Goddess. No clear paternal descent is discoverable. The women, however, have a completely different and aniconic goddess religion that doesn't occupy much psychological space. The ruling women are clearly manipulating the men's religion for control of the men. At 10:17 AM 2/2/00 -0500, you wrote: >Thanks, Nancy, for your useful and insightful post on feminist myth in >science fiction. > >> Any other suggestions of books/authors exploring intersection of >> religion/myth and gender? >> >I wonder if we might also consider Sherri Tepper's *The Gate to Women's >Country* and Pamela Sargent's *The Shore of Women.* I always forget which >of these books is which, since they have a lot in common, and I read them >a couple of years ago one after the other. Either way, both deal with >women living inside a gated community while men live outside. I believe >that both have a goddess figure. Certainly, one of them has a situation >whereby the women inside the gated community create a goddess in order to >control the men. Both very interesting books that I should definitely >read again! And that I would highly recommend. > >Cheers, > >pamela bedore >department of english >university of rochester > Nancy Phillips, M.D. phone:(314)577-8782 Pathology fax:(314)268-5120 St. Louis University Hospital email: phillinj@slu.edu 3635 Vista Ave. St. Louis, MO, 63110, USA aacgccaattgctatccccatattctgctaatcccgagcatggac ========================================================================= Date: Thu, 3 Feb 2000 06:47:51 PST Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Daniel Krashin Subject: Gender/Myth Intersections Mime-Version: 1.0 Content-Type: text/plain; format=flowed >From: Automatic digest processor >Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC > >To: Recipients of FEMINISTSF-LIT digests >Subject: FEMINISTSF-LIT Digest - 1 Feb 2000 to 2 Feb 2000 (#2000-18) >Date: Thu, 3 Feb 2000 00:05:57 -0600 > >There are 2 messages totalling 103 lines in this issue. > >Topics of the day: > > 1. Gender/Myth Intersections (2) > >---------------------------------------------------------------------- > >Date: Wed, 2 Feb 2000 10:17:11 -0500 >From: Pamela Bedore >Subject: Gender/Myth Intersections > >Thanks, Nancy, for your useful and insightful post on feminist myth in >science fiction. > > > Any other suggestions of books/authors exploring intersection of > > religion/myth and gender? > > >I wonder if we might also consider Sherri Tepper's *The Gate to Women's >Country* and Pamela Sargent's *The Shore of Women.* I always forget which >of these books is which, since they have a lot in common, and I read them >a couple of years ago one after the other. Either way, both deal with >women living inside a gated community while men live outside. I believe >that both have a goddess figure. Certainly, one of them has a situation >whereby the women inside the gated community create a goddess in order to >control the men. Both very interesting books that I should definitely >read again! And that I would highly recommend. > >Cheers, > >pamela bedore >department of english >university of rochester > >------------------------------ > >Date: Wed, 2 Feb 2000 18:52:22 -0600 >From: Nancy Phillips >Subject: Re: Gender/Myth Intersections > >Both Sherri Tepper's *The Gate to Women's Country* and Pamela Sargent's >*The Shore of Women* are post-nuclear holocaust Earth novels, as are many >SF of female-dominant societies. > >Tepper's Gate seemed to have myth and ritual but no deistic religion. Women >enacted a rewritten Iphigenia in Aulis, emphasising the futility of total >war and the cost to women (and mocking male warriors as clowns with large >fake penises, a la classical comedy). Men saluted the phallus and had other >rites of passage to manhood, to warriorhood, after death in glorious >battle. Noone yearned for transcendence. Although the Iphigenia myth is >Greek in origin and the men's rituals and social organisation are generic >Bronze Age, the only recognisable religion lies outside the society, in a >group of polygamists resembling the most brutal stereotype of the early >Mormons. The ruling women supported the men's warrior society as a place to >put the "culls", and kept the men that could not fit into warrior society >as nominal household servants in the women's community, with real roles as >"secret" husbands and political advisors. The ruling women's manipulations >of men lay in the control of reproduction, by enabling non-ruling women to >have sex with the glamorous warriors, but inseminating these women with >"superior" sperm of the household servants. The goal was to breed peaceable >men capable of cooperating with women. [de-lurking] As a lifelong amateur student of religion, I would point out that not all religions are transcendent. One definition of religion that I particularly like is "culturally mediated interaction with culturally postulated superhuman entities". I like that because it includes everything from Zen to Judaism to Santeria. By that standard, the men's phallus cult certainly qualifies: I recall all the men standing in front of their menhir, chanting the names of Odysseus and Telemachus and (IIRC) asking for strength and courage. That sure seems like religion to me. Actually, I have to say, that description was oddly moving for me. It was an interesting experience to read _Gate_ and know that if I'd grown up in that culture, I'd have, without a doubt, stayed in men's country (though I don't think I'd have liked it much). The women's corresponding cult seemed more of a political ritual, but who knows? We see it mostly through the eyes of a down-to-earth young woman who is quite cynical and disillusioned by the end of the novel. Not having read _Shore of Women_, I will now shut up. Dan Krashin ______________________________________________________ Get Your Private, Free Email at http://www.hotmail.com ========================================================================= Date: Sat, 5 Feb 2000 19:53:16 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Janice E. Dawley" Subject: BDG: Dawn Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii" I finished *Dawn* this afternoon and thought I would get my thoughts down now rather than waiting for the official start of the discussion on Monday. I found that, as with *Wild Seed*, the story gripped me, despite occasional irritation with what I'm beginning to think of as the author's blind spots. Her strength is her imagination of the alien. I really enjoyed learning about the Oankali's physiology and the way the ship worked. And at the end, the revelation of how the ooloi made themselves indispensable in sexual relationships was a creepy extrapolation of what we already had been told. The book is well-paced -- Lilith starts out in the "Womb" and works her way to the "Training Room" as we learn more and more about the Oankali and their plans and observe the growth of Lilith's relationship to Nikanj. I found this interesting, but the introduction of the other human characters was the point at which I felt the story would really bloom. I enjoyed the suspense of Lilith's overview of the dossiers -- it seemed almost like a mystery novel's review of the suspects, in reverse -- but when she actually began awakening people I was disappointed to find that the new characters were a lot less interesting than their profiles had led me to believe. I've concluded that Butler simply is not good at characterization. She knows that people have real differences that are acted out in their behavior, but when it comes to writing their dialogue or describing them in action, she makes them stereotyped and uninteresting. >From a feminist standpoint, I have a few problems with the book. Butler is very aware of feminist issues, but only to a point, at which she seems to become completely blind. There is more than one attempted rape in the novel, and the rapists are portrayed as brutish, though fairly typical, human men. The Oankali go so far as to say that there is something genetically wrong with human males that makes them behave in this way. Yet, at the end of the book, Nikanj reveals to Lilith that it has impregnated her without her knowledge or consent! Lilith is not happy about the situation, but only because the child won't be "human", not because she's unhappy about being pregnant. Throughout the book the women have known that they will probably be used in breeding experiments (though they don't know the details), and NONE of them react with the horror that I would feel at the thought of being forced to bear children. I don't find it believable. Just as I don't find it believable that not one of the 43 humans awakened by Lilith is homosexual. Butler could have gotten around the issue by explaining homosexuality as a genetic imperfection that the Oankali have fixed (as Sheri Tepper did in *The Gate to Women's Country*). I wouldn't have been happy about it, but at least she would have shown some awareness that gay people really exist. There is no such explanation, though there is a clear opportunity for one when Nikanj asks Lilith what a "faggot" is. Very strange. Another problem from a feminist standpoint is the lack of secondary female characters of any consequence. Near the end of the book Lilith thinks about how much she misses Tate and how there are no other close friends to take her place -- but since we were given no evidence of their friendship to begin with this doesn't carry much weight. The only characters that ever felt important to Lilith were Nikanj and Joseph -- one ooloi, one male. Did anyone else notice how willing the Oankali were to behave like masters, despite their reservations about the human tendency toward hierarchy? Particularly in the beginning of the book, I was infuriated with their withholding of information when there seemed no point to it -- it seemed just a means of letting Lilith know who was boss. The fact that none of the human characters ever called them on this behavior made no sense to me. I think I will stop there. What do other people think? ----- Janice E. Dawley.....Burlington, VT http://homepages.together.net/~jdawley/ Listening to: Lo Fidelity Allstars -- How to Operate with a Blown Mind "...the public and the private worlds are inseparably connected; the tyrannies and servilities of the one are the tyrannies and servilities of the other." Virginia Woolf, Three Guineas ========================================================================= Date: Sat, 5 Feb 2000 18:34:10 -0700 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Magdalena A. K. Muir" Subject: Re: BDG: Dawn In-Reply-To: <3.0.1.32.20000205195316.006ada18@together.net> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Respponse to comments on "Dawn", and writings of Octavia Butler. I also apologize for preempting the date of the discussion, but wanted to respond to Janice's email while it was fresh in my mind. I have read almost of Butler's books, as well as the selected book, Dawn. I enjoy Butler's book because of the ideas they explore, such as what is community,religion, or with Dawn, the impact on people and culture of changing human sexuality and reproduction to require aliens. I share some of Janice's thoughts with respect to plot and characterization for these books. The plot and motivations do not always seem believable, and male and female characters seem to function within relatively narrow roles. I don't enjoy the characterization of most males as being capable of extreme brutality, as that seems a limited view of human beings. Aliens aren't quite as typecast so they can be more interesting. With Dawn, the premise of aliens preserving a sufficient number to observe, breed, reproduce with and in some way use their genetic material, did not altogether flow for me. However, it permitted interaction with aliens on very intimate ways. One question the novel raised for me, and that I would like to raise for others, is whether human beings would be so hostile to alien contact and interaction. There seem to very strong emphasis on that instinctive revulsion, and the use of it to justify even the murder of one's fellow humans. Magdalena > -----Original Message----- > From: Feminist SF/Fantasy and Utopia Literature ON TOPIC > [mailto:FEMINISTSF-LIT@LISTSERV.UIC.EDU]On Behalf Of Janice E. Dawley > Sent: February 5, 2000 17:53 > To: FEMINISTSF-LIT@LISTSERV.UIC.EDU > Subject: [*FSF-L*] BDG: Dawn > > > I finished *Dawn* this afternoon and thought I would get my thoughts down > now rather than waiting for the official start of the discussion > on Monday. > > I found that, as with *Wild Seed*, the story gripped me, despite > occasional > irritation with what I'm beginning to think of as the author's > blind spots. > Her strength is her imagination of the alien. I really enjoyed learning > about the Oankali's physiology and the way the ship worked. And > at the end, > the revelation of how the ooloi made themselves indispensable in sexual > relationships was a creepy extrapolation of what we already had been told. > > The book is well-paced -- Lilith starts out in the "Womb" and > works her way > to the "Training Room" as we learn more and more about the Oankali and > their plans and observe the growth of Lilith's relationship to Nikanj. I > found this interesting, but the introduction of the other human characters > was the point at which I felt the story would really bloom. I enjoyed the > suspense of Lilith's overview of the dossiers -- it seemed almost like a > mystery novel's review of the suspects, in reverse -- but when > she actually > began awakening people I was disappointed to find that the new characters > were a lot less interesting than their profiles had led me to > believe. I've > concluded that Butler simply is not good at characterization. She knows > that people have real differences that are acted out in their > behavior, but > when it comes to writing their dialogue or describing them in action, she > makes them stereotyped and uninteresting. > > >From a feminist standpoint, I have a few problems with the book. > Butler is > very aware of feminist issues, but only to a point, at which she seems to > become completely blind. There is more than one attempted rape in the > novel, and the rapists are portrayed as brutish, though fairly typical, > human men. The Oankali go so far as to say that there is something > genetically wrong with human males that makes them behave in this > way. Yet, > at the end of the book, Nikanj reveals to Lilith that it has impregnated > her without her knowledge or consent! Lilith is not happy about the > situation, but only because the child won't be "human", not because she's > unhappy about being pregnant. Throughout the book the women have > known that > they will probably be used in breeding experiments (though they don't know > the details), and NONE of them react with the horror that I would feel at > the thought of being forced to bear children. I don't find it believable. > > Just as I don't find it believable that not one of the 43 humans awakened > by Lilith is homosexual. Butler could have gotten around the issue by > explaining homosexuality as a genetic imperfection that the Oankali have > fixed (as Sheri Tepper did in *The Gate to Women's Country*). I wouldn't > have been happy about it, but at least she would have shown some awareness > that gay people really exist. There is no such explanation, > though there is > a clear opportunity for one when Nikanj asks Lilith what a "faggot" is. > Very strange. > > Another problem from a feminist standpoint is the lack of secondary female > characters of any consequence. Near the end of the book Lilith > thinks about > how much she misses Tate and how there are no other close friends to take > her place -- but since we were given no evidence of their friendship to > begin with this doesn't carry much weight. The only characters that ever > felt important to Lilith were Nikanj and Joseph -- one ooloi, one male. > > Did anyone else notice how willing the Oankali were to behave > like masters, > despite their reservations about the human tendency toward hierarchy? > Particularly in the beginning of the book, I was infuriated with their > withholding of information when there seemed no point to it -- it seemed > just a means of letting Lilith know who was boss. The fact that > none of the > human characters ever called them on this behavior made no sense to me. > > I think I will stop there. What do other people think? > > ----- > Janice E. Dawley.....Burlington, VT > http://homepages.together.net/~jdawley/ > Listening to: Lo Fidelity Allstars -- How to Operate with a Blown Mind > "...the public and the private worlds are inseparably connected; > the tyrannies and servilities of the one are the tyrannies and > servilities of the other." Virginia Woolf, Three Guineas > ========================================================================= Date: Sun, 6 Feb 2000 09:03:32 -0000 Reply-To: billinger@enterprise.net Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Elizabeth Billinger Subject: Re: BDG: Dawn In-Reply-To: <000001bf7042$4412abd0$8546e4cf@dial.cadvision.com> MIME-Version: 1.0 Content-type: text/plain; charset=US-ASCII Content-transfer-encoding: 7BIT Magdalena asked: > One question the novel raised for me, and that I would like to raise for > others, is whether human beings would be so hostile to alien contact and > interaction. There seem to very strong emphasis on that instinctive > revulsion, and the use of it to justify even the murder of one's fellow > humans. I hope that I would be more open and curious, though I have a generally cautious nature. I hope that there would be a number of other people - the ones who read sf maybe - who would also be interested in the possibilities such contact brings. I fear, however, that there would be an overwhelming majority responding with instinctive revulsion. The rest of Europe is not actually alien, but you'd think it was if you heard the reaction in the press, and from real live people, to the idea of Britain becoming a more integral part of the European Community. To move from imperial measurements to metric, to change our currency from the pound to the euro - these things are perceived as a dangerous loss of identity and heralds of the end of the world as we know it. How much more resistance there would be to any kind of co- operation with little green men... Lizbeth ========================================================================= Date: Sun, 6 Feb 2000 10:42:51 -0700 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Magdalena A. K. Muir" Subject: Dawn MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Elizabeth, I appreciate your point as I was recently in England. London is very multi-cultural but also markedly different from the country, and it seems sometimes an uneasy fit. Based on that trip and travels to cultures that are more homogenious, I can clinically understand the sense of nationalism that peoples can feel, particularly when one is under some from of threat or forced to co-exist with the Other. However, it is somewhat inconsistent with my experience. I live in Canada, which like much of the Americas is an ethnic mix with no clear majority, and an identity formed from a merger of peoples. That informs my bias and how I interpret fiction. To apply that to Dawn, does a story like this with an eventual and painful merger of humans with aliens, arise because of the mixed culture and diversity of the author's society? Another way to put that question is would this story, or even Butler's be written by someone who does not arise from a muticultural society? Magdalena > -----Original Message----- > From: Feminist SF/Fantasy and Utopia Literature ON TOPIC > [mailto:FEMINISTSF-LIT@LISTSERV.UIC.EDU]On Behalf Of Elizabeth Billinger > Sent: February 6, 2000 02:04 > To: FEMINISTSF-LIT@LISTSERV.UIC.EDU > Subject: Re: [*FSF-L*] BDG: Dawn > > > Magdalena asked: > > > One question the novel raised for me, and that I would like to raise for > > others, is whether human beings would be so hostile to alien contact and > > interaction. There seem to very strong emphasis on that instinctive > > revulsion, and the use of it to justify even the murder of one's fellow > > humans. > > I hope that I would be more open and curious, though I have a > generally cautious nature. I hope that there would be a number of > other people - the ones who read sf maybe - who would also be > interested in the possibilities such contact brings. I fear, however, > that there would be an overwhelming majority responding with > instinctive revulsion. > The rest of Europe is not actually alien, but you'd think it was if you > heard the reaction in the press, and from real live people, to the > idea of Britain becoming a more integral part of the European > Community. To move from imperial measurements to metric, to > change our currency from the pound to the euro - these things are > perceived as a dangerous loss of identity and heralds of the end of > the world as we know it. > How much more resistance there would be to any kind of co- > operation with little green men... > > Lizbeth > ========================================================================= Date: Sun, 6 Feb 2000 16:04:19 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Jocelyn & Sheryl Subject: Re: BDG: Dawn MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Responding to Janice's post: >snip< >Just as I don't find it believable that not one of the 43 humans awakened >by Lilith is homosexual. All the more problematic, I think, when one realizes that Butler herself is homosexual. >more snipping< >Did anyone else notice how willing the Oankali were to behave like masters, >despite their reservations about the human tendency toward hierarchy? >Particularly in the beginning of the book, I was infuriated with their >withholding of information when there seemed no point to it -- it seemed >just a means of letting Lilith know who was boss. The fact that none of the >human characters ever called them on this behavior made no sense to me. > >I think I will stop there. What do other people think? I think it's hard to discuss _Dawn_ in the absence of the two following books in the trilogy. As the story progresses, the humans find it harder and harder to put up with the Oankali decisions about humanity's future. There are human separatists, etc. It may be, to be kind to _Dawn_, that in the first book the humans may still be reeling from the realization of what has happened to them. Sheryl ========================================================================= Date: Sun, 6 Feb 2000 18:04:11 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Elizabeth Pandolfo/Briggs Subject: Re: Dawn Mime-Version: 1.0 Content-Type: text/plain; charset=us-ascii On Sun, Feb 06, 2000 at 10:42:51AM -0700, Magdalena A. K. Muir wrote: > Based on that trip and travels to cultures that are more homogenious, I can > clinically understand the sense of nationalism that peoples can feel, > particularly when one is under some from of threat or forced to co-exist > with the Other. However, it is somewhat inconsistent with my experience. I > live in Canada, which like much of the Americas is an ethnic mix with no > clear majority, and an identity formed from a merger of peoples. That > informs my bias and how I interpret fiction. I am surprised that you've lived in Canada and not come across situations of nationalism, such as tension between English- and French-heritage peoples, those majority groups and immigrants of other nationalities, and whites and native peoples. Those issues are frequently dealt with in literatures from Canada that I've read, and have strikingly come up in conversations my husband and I have with Canadian friends. Also, as an American, I'd like to point out that currently there is a clear ethnic majority (white), although that majority is expected to be affected in the next 10 years by increases in the black and Hispanic populations. In different areas of the US, where majority ethnicities come in contact with minority ones (and those will depend on the region), there are strong, even violent ethnic feelings, leanings, and disputes. There are also vast differences in what people around the US consider their identities. I find Butler's depiction of the violent feelings and actions by the humans against the Oankali to be unexaggerated and realistically depicted. Like Lizbeth mentioned, the UK can be an excellent example of how such tensions play out (as can the US), and that's humans against humans (I attend the University of Wales, Cardiff, studying Welsh nationalism, etc., and got some shocking first-hand examples of nationalistic and ethnic discriminatory behavior while I lived there, since Wales is a colonized country dominated by England). > To apply that to Dawn, does a story like this with an eventual and painful > merger of humans with aliens, arise because of the mixed culture and > diversity of the author's society? Another way to put that question is would > this story, or even Butler's be written by someone who does not arise from a > muticultural society? >From my research on Butler, her primary concerns in her novels are the dangers of hierarchy. She feels humans are essentially hierarchical, and unable to function in any other fashion societally. To her, that is humans' fatal flaw. She uses her novels to explore these ideas from various perspectives; in _Dawn_, from the pespectives of male vs. female and human vs. alien. I feel she's making a statement about how multicultural societies operate only tangentially, as another example of society forming around a power-based hierarchy. Elizabeth Elizabeth L. Pandolfo Briggs pandolfo@ninthwonder.com www.ninthwonder.com/~pandolfo ========================================================================= Date: Sun, 6 Feb 2000 19:35:24 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Nancy Phillips Subject: Dawn MIME-version: 1.0 Content-type: text/plain; charset="us-ascii" I haven't read the Oankali trilogy for about a year, my second reading. Miscegenation. Slavery. Survival. I doubt that this book would have been written by a white writer, or by a black man. In the Oankali system, both human sexes are made subjects of the Oankali-controlled reproduction, although of course only the human female bears. This does differ from the US slave system, where slave male reproductive capacity was not directly accessed by white owners, though strong and healthy slave men could be encouraged to spread their seed around among the available slave women. Of course the slave female reproductive capacity was directly accessed by white owners - by rape or by reward - and the Jefferson estate association recognition fo the Heming lineage is the latest acknowledgement of a fact that is immediately apparent to all Americans who have eyes to see. Of course there is much more to the novel. The depiction of the human men as largely brutal may be in part due to the complete collapse of society post-holocaust. Gentleness and cooperation are not survival traits when there is little social cohesion in the first place. In some ways I do not see this as a "feminist" or "anti-male" trope as much as a "post-holocaust" trope. The Oankali both rescue samples of the life on Earth from supposedly inevitable death after the nuclear holocaust, and doom the Earth and its remaining unaltered life to annihilation. The planet is supposed to rip apart when the bio-spaceships growing on Earth have completely developed and are ready to leave the system. Lilith is told this fairly early on, and chooses to promote human survival in a hybrid human-Oankali form. She really hates herself for doing so, and is hated by other humans as a collaborationist and traitor. It isn't a classic master/slave relationship, because the Oankali offered survival after a human-caused holocaust, and the Oankali eventually offer (SPOILER) a terraformed planet for use of humans that will not breed with Oankali (END SPOILER). There are some distinctly unpleasant aspects to the Oankali treatment of humans. The Oankali objectify humans, not for their beauty, but for their novel human genetic content. Lilith is a star because she has hereditary cancer. In some cases the men just can't deal with being treated "just like women" - not equal to the Oankali, human person's worth to Oankalis based on some characteristic (genetics) out of that person's control. The humans are not told the whole truth on the human-Oankali relationship (SPOILER - humans in an H/O relationship can't ever have physical sex with other humans - END SPOILER). Nancy Phillips, M.D. phone:(314)577-8782 Pathology fax:(314)268-5120 St. Louis University Hospital email: phillinj@slu.edu 3635 Vista Ave. St. Louis, MO, 63110, USA aacgccaattgctatccccatattctgctaatcccgagcatggac ========================================================================= Date: Sun, 6 Feb 2000 20:03:21 -0700 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Magdalena A. K. Muir" Subject: Re: Dawn In-Reply-To: <20000206180411.A12783@canolog.ninthwonder.com> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Elizabeth I take your point about tensions between groups in Canada, and distinct ethnic tensions. I work extensively with First Nations, and historically with some aspects of Quebec separatism here. I am also embarking on some human right work in Europe with Gypsies. However, I will still assert that in Canada there is no clear majority ethnic population in English speaking Canada. While some parties resent this, and this gives rise to racism and discrimination, to be a Canadian is not to be defined ethnically, but to be defined culturally. You may assert differently for the US, and I would be defer to you on that point. However, many countries have clear ethnic majorities, and the definition of nationalism is tha of race. What is the relevance of this to Dawn; in an ethnically defined society, the stranger is always the outcast and can never merge with the society. If the book is a parable, how does one address the stranger and redefine what it means to be part of the society. There is also parallels to sexual identity: are we born with it, or do we choose it? Do we have to behave in a certain way because of an accident of birth? May we make choices in partners, lifestyle and perspectves irrespective of our or other person's gender or race? To me, this is very relevant as one tries to apply fiction to the modern world, and understand how to create a more flexible society in an interconnected world. Thanks for your patience with my comments,and apreciate any thoughts. I will listen to the next few days to others' discussion, and defer intruding. > -----Original Message----- > From: Feminist SF/Fantasy and Utopia Literature ON TOPIC > [mailto:FEMINISTSF-LIT@LISTSERV.UIC.EDU]On Behalf Of Elizabeth > Pandolfo/Briggs > Sent: February 6, 2000 16:04 > To: FEMINISTSF-LIT@LISTSERV.UIC.EDU > Subject: Re: [*FSF-L*] Dawn > > > On Sun, Feb 06, 2000 at 10:42:51AM -0700, Magdalena A. K. Muir wrote: > > > Based on that trip and travels to cultures that are more > homogenious, I can > > clinically understand the sense of nationalism that peoples can feel, > > particularly when one is under some from of threat or forced to co-exist > > with the Other. However, it is somewhat inconsistent with my > experience. I > > live in Canada, which like much of the Americas is an ethnic mix with no > > clear majority, and an identity formed from a merger of peoples. That > > informs my bias and how I interpret fiction. > > I am surprised that you've lived in Canada and not come across situations > of nationalism, such as tension between English- and French-heritage > peoples, those majority groups and immigrants of other nationalities, and > whites and native peoples. Those issues are frequently dealt with in > literatures from Canada that I've read, and have strikingly come up in > conversations my husband and I have with Canadian friends. > > Also, as an American, I'd like to point out that currently there is a > clear ethnic majority (white), although that majority is expected to be > affected in the next 10 years by increases in the black and Hispanic > populations. In different areas of the US, where majority ethnicities > come in contact with minority ones (and those will depend on the region), > there are strong, even violent ethnic feelings, leanings, and disputes. > There are also vast differences in what people around the US consider > their identities. > > I find Butler's depiction of the violent feelings and actions by > the humans against the Oankali to be unexaggerated and realistically > depicted. Like Lizbeth mentioned, the UK can be an excellent example of > how such tensions play out (as can the US), and that's humans against > humans (I attend the University of Wales, Cardiff, studying Welsh > nationalism, etc., and got some shocking first-hand examples of > nationalistic and ethnic discriminatory behavior while I lived there, > since Wales is a colonized country dominated by England). > > > To apply that to Dawn, does a story like this with an eventual > and painful > > merger of humans with aliens, arise because of the mixed culture and > > diversity of the author's society? Another way to put that > question is would > > this story, or even Butler's be written by someone who does not > arise from a > > muticultural society? > > >From my research on Butler, her primary concerns in her novels are the > dangers of hierarchy. She feels humans are essentially hierarchical, and > unable to function in any other fashion societally. To her, that is > humans' fatal flaw. She uses her novels to explore these ideas from > various perspectives; in _Dawn_, from the pespectives of male vs. female > and human vs. alien. I feel she's making a statement about how > multicultural societies operate only tangentially, as another example of > society forming around a power-based hierarchy. > > Elizabeth > > > Elizabeth L. Pandolfo Briggs > pandolfo@ninthwonder.com > www.ninthwonder.com/~pandolfo > ========================================================================= Date: Sun, 6 Feb 2000 14:51:08 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Robin Reid Subject: Re: BDG Dawn/Contact with "Others" In-Reply-To: <200002060905.JAA11340@mail.enterprise.net> Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii"; format=flowed A quick response to the question about how humans would react to "alien contact and > > interaction. There seem to very strong emphasis on that instinctive > > revulsion, and the use of it to justify even the murder of one's fellow > > humans." I think Butler's descriptions are fairly close to what would happen. Look how we use the term "alien" to describe other human beings; how, historically cultures have reacted to humans from cultures that are perceived as "different' (categorizing them as inferior because of that difference); how so many people are freaked out by anyone who is perceived as different from them (skin color, language, sexual identity); the fear and loathing expressed in the need to control "Others." And these are all attitudes about other human beings. How would the majority of humans respond to aliens appearing--let along, human beings who have barely survived the nuclear holocaust which precedes events in Butler's trilogy. (One of the few sf novels I've read that pointedly argues that the majority of people killed immediately in an all out nuclear war would be the populations of the major industrialized countries who have their armaments aimed at each other, with "black and brown peoples" being mostly untargeted--at the time that Butler was writing this book anyway.) Lots of other post-nuclear war novels seem to think only white Anglos or white Europeans would survive..... I haven't read the novel recently, but read the trilogy many times in the past, and have heard good presentations about it.....the issue of her female characters response to the breeding situation has been seen as problematic by a number of feminist critics I've read/heard speak. I agree although I think the way she is interested in focusing on the specific situation of slavery and forced breeding (an sf take on American slavery) and the ultimate issue of survival: it does make me terribly uncomfortable, but I have to ask, if I was in Lilith's position, what would I be able to do? Butler's characters always have situations in which they have little choice as to what they can DO--the issue may well be what they are thinking as well. Her works always grabs me, makes me think, keeps me coming back for multiple readings, and won't let me ignore it. Robin ========================================================================= Date: Sun, 6 Feb 2000 20:28:02 -0800 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Sandy Candioglos Subject: Re: BDG Dawn/Contact with "Others" MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit > I think Butler's descriptions are fairly close to what would happen. Look > how we use the term "alien" to describe other human beings; how, > historically cultures have reacted to humans from cultures that are > perceived as "different' (categorizing them as inferior because of that > difference); how so many people are freaked out by anyone who is perceived > as different from them (skin color, language, sexual identity); the fear > and loathing expressed in the need to control "Others." And these are all > attitudes about other human beings. I see what you're saying, but I also had a problem with that aspect of the book; in my own life, I don't see _revulsion_ toward the "other" when the situation is one-on-one (as it is when Lilith first wakes up in the little room). Group-on-group, or one-on-group, yes, but not one-on-one. Maybe it's just me... > I haven't read the novel recently, but read the trilogy many times in the > past, and have heard good presentations about it.....the issue of her > female characters response to the breeding situation has been seen as > problematic by a number of feminist critics I've read/heard speak. I agree > although I think the way she is interested in focusing on the specific > situation of slavery and forced breeding (an sf take on American slavery) > and the ultimate issue of survival: it does make me terribly > uncomfortable, but I have to ask, if I was in Lilith's position, what would > I be able to do? Butler's characters always have situations in which they > have little choice as to what they can DO--the issue may well be what they > are thinking as well. Her works always grabs me, makes me think, keeps me > coming back for multiple readings, and won't let me ignore it. This is EXACTLY what I LOVE about Butler's books; no matter how frustrated I am with the characters, no matter how upset the situations they're in make me, her books ALWAYS grab me and don't let go; they all make me THINK, usually about things no other book has quite made me think about before. -Sandy ========================================================================= Date: Mon, 7 Feb 2000 08:06:22 -0800 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Lyla Miklos Subject: Re: BDG: Dawn MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii I read Dawn back in the summer last year and it's sequel, although I still haven't read the final chapter of the trilogy. I have also read a collection of short stories by Butler whic I found equally thought provoking. > I share some of Janice's thoughts with respect to > plot and characterization > for these books. The plot and motivations do not > always seem believable, and > male and female characters seem to function within > relatively narrow roles. This bothered me too. I always worry when sf feminist books say that all men are genetically inclined to brutishness. I think that men behaving in these kinds of ways are learned behaviours not simply a part of being male. Yesterday on CBC Radio One on a show called Tapestry they had a piece on about a former nun who wrote a book called "Is The Pope Catholic?" In the interview she said that the Catholic Church's ruling that women can't be priests opens the door to abuse against women because you've already told your folowers that a woman is not equal to a man so the same rules don't apply to her. I guess I'm straying from the point, but it is frightening when we say women are this way and men are that way no matter how you slice it. > One question the novel raised for me, and that I > would like to raise for > others, is whether human beings would be so hostile > to alien contact and > interaction. There seem to very strong emphasis on > that instinctive > revulsion, and the use of it to justify even the > murder of one's fellow > humans. The immediate revulsion that all the characters feel really threw me off too. I mean we encounter "alien" lifeforms all the time on this planet. Note to all! Humans are not the only species on this planet!?! I suppose to see Jabba the Hutt on the screen in Jedi is one thing, but if I actually encounter a living and breathing and pungent Jabba live and in person it might be a whole other matter. Although I don't know if I would go into spasms apon seeing him. > > Her strength is her imagination of the alien. I > really enjoyed learning > > about the Oankali's physiology and the way the > ship worked. The very in depth description of the Oankali was perhaps one of the most fascinating parts of the novel. They were cool and very different as a species. A totally different structure in every way from humans. > -- but when she actually > > began awakening people I was disappointed to find > that the new characters > > were a lot less interesting than their profiles > had led me to > > believe. Yes, the people Lilith wakes up all rapidly became charicatures and not charcters anymore. It reminded me of watching disaster movies where you have the mother, the single rich guy, the black guy from the rough neighbourhood, the lesbian, the teenaged virgin, and that's all these people are - a label. They are nothing more than tokens. > The Oankali go so far as to say that > there is something > > genetically wrong with human males that makes them > behave in this > > way. Once again a disturbing theory no matter how you shake it. It always reminds me of this list I used to be on called poli-dykes. It was for politically active lesbians. I unsubbed from it when someone suggested that all babies born with a penis should be killed on the spot because they will become rapists. Too my utter horror several people on the list agreed with this view and when I put up a post expressing my disgust with this view I quickly became a pariah and shortly after un-subbed. If you enforce the view that you are limited to only certain possibilities because of your gender, race, sexual orientation, height, weight, or physicial disability you are opening the floodgates of prejudice. EX: I am on the Alumni Board for Mohawk College. Every year we submit outstanding Mohawk grads to win the annual Premier's awards. Our guy (Master T from Much Music) lost in the arts category this year, to who? A guy who has no arms or legs and yet he is a world renowned choreographer. Yet another example of you can do anything if you put your mind to it. > Lilith is not happy about the > > situation, but only because the child won't be > "human", not because she's > > unhappy about being pregnant. That part of the book really bothered me. Because basically the Oankali raped her and impregnated her without her consent. It was real blow to me and to Lilith. What a rape of trust! I thought her reaction was a little odd too. > > Just as I don't find it believable that not one of > the 43 humans awakened > > by Lilith is homosexual. You know what I hadn't even thought about that until you brought it up. Perhaps if an explanation of we need to increase the species so homosexuals won't do us too much good right now might have worked, but eh? But isn't there an actor guy who turns out to be gay and decides to live by himself away from the otehrs. I can't remember, it has been a while. Some details have become rather fuzzy. > > explaining homosexuality as a genetic imperfection > that the Oankali have > > fixed (as Sheri Tepper did in *The Gate to Women's > Country*). It has been a while since I read Gate. I don't remember homosexuality being explained away like that. I will have to read it again. > > Particularly in the beginning of the book, I was > infuriated with their > > withholding of information when there seemed no > point to it -- it seemed > > just a means of letting Lilith know who was boss. Yes that duplicity bothered me as well. It didn't seem very honest. > > I think I will stop there. What do other people > think? One attitude that was very prevelant from the humans was a "Who do these aliens think they are? How dare they?" stance that really irked me. I kind of felt that these humans had no right to complain. Here are these aliens giving you a second chance after you completely destroyed your own planet. Who do you guys think YOU are? Even in the sequel to DAWN the resistance movement and all that jazz. It really bothered me. Perhaps working with them would be best since you would be DEAD otherwise!?! The Oankali did at times come across as being a tad self righteous, but then again they didn't destroy themselves and their home world so who am I as a lowly human to talk (wink, wink, nudge, nudge). If nothing else DAWN disturbed me. It left me feeling unsettled and rattled. I was thinking it was a comment on slavery, but Butler has said in numerous interviews that slavery as we have know it especially in the United States wasn't quite what she was aiming for. I haven't read the last book in the trilogy, perhaps the final answer lies there. I'd love to hear more from other people who have read it. Lyla __________________________________________________ Do You Yahoo!? Talk to your friends online with Yahoo! Messenger. http://im.yahoo.com ========================================================================= Date: Mon, 7 Feb 2000 11:52:49 -0800 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Jessie Stickgold-Sarah Subject: Re: Dawn In-Reply-To: <000601bf7117$e43c5950$8546e4cf@dial.cadvision.com> Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii"; format=flowed Magdalena wrote: >However, I will still assert that in Canada there is no clear majority >ethnic population in English speaking Canada. While some parties resent >this, and this gives rise to racism and discrimination, to be a Canadian is >not to be defined ethnically, but to be defined culturally. I've been reading recently about the issues of immigration in Western Europe, an area which historically has not been very immigrant-friendly. One comment was made that anyone could become French (for example) but you had to really *be French*. The assumption was that an immigrant would completely embrace French culture, rather than bringing her own culture and adding it to the stewpot--which is, of course, the American Way. I found that fascinating, because it had never occured to think about it that way. One might argue that this is exactly what's happening to the humans in Dawn: they're invited to join the Oankali, but solely on their terms. Jessie ========================================================================= Date: Mon, 7 Feb 2000 22:36:30 -0000 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Jane Fletcher Subject: Re: Dawn MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 8bit Hi All I^Òm new this list, and I hesitate to post my thoughts since I haven^Òt yet read the book for the month; however the reason why I put off reading it is pertinent to the current discussion. I have only once tried reading a book by Bulter and gave up a quarter of the way in, just because I was getting so irritated by her heavy-handed characterisation of the bad-guys (mainly human males). I don^Òt mind two-dimensional stereotypes in their place. I can thoroughly enjoy a fantasy epic with the forces of darkness as no more than identikit villains, but I rapidly lose patience when a author makes it clear they are writing a ^Ñserious^Ò book and then produces a one-side, blinkered analysis that answers nothing. The same applies to a discussion of xenophobia in the UK. Against the tabloid headlines you have to put statistics such as that 50% of the black population of the UK have white partners. I^Òll bet the people who write and read the anti-EEC headlines drink French wine, eat Italian pasta, buy German cars and go on holiday to Spain. Even the most simple-minded of racists can be ambiguously complex. I still muse on the conversation I overheard years ago in a London pub: person A ^Ö I can^Òt stand blacks. person B (indignantly) ^Ö Your best-mate Pete is black. person A ^Ö Oh^Å yeah^Å but I don^Òt think of Pete as black. And in response to Jessie^Òs statement >>I've been reading recently about the issues of immigration in Western Europe, an area which historically has not been very immigrant-friendly.<< I would point out that the reason Western Europe seems so racially homogenous is because immigrants have traditionally been absorbed by intermarriage ^Ö at the abolition of the slave trade Lisbon was 20% black. Walking its streets today you can see virtually no sign of the freed slaves contribution to the ethnic mix. As for human reaction to alien contact, I don^Òt know if anyone on the list has read Gwyneth Jones' ^ÑNorth Wind^Ò, but to my mind it contains an extremely plausible depiction of it ^Ö varied, changing, irrational, pro, anti, confused, posturing and ultimately doomed. It is also very interesting from a feminist viewpoint. To get back to ^ÑDawn^Ò; when I saw that the book for February was by Butler I didn^Òt fancy reading it, but I know I am wrong to form an opinion of an author on the basis of one partially read book. From the discussion so far I suspect that reading the book may not change my view of her writing, however it is unfair (and unwise) to criticise from a position of ignorance, so I promise to read the book and get back to the debate when I have some better-informed things to say. Jane ========================================================================= Date: Mon, 7 Feb 2000 18:00:54 -0700 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Magdalena A. K. Muir" Subject: Re: Dawn- We are all social constructs In-Reply-To: <4.2.0.58.20000207114757.009cd490@mail1.pa.bell-labs.com> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit It was interesting to see the response and comments about cultural integration and who is the alien both in France (below), and Jane's comment with respect to cultural diversity and acceptance in England and Portugal. I would like to illustrate this with an example from Canada. Quebec receives many French language immigrants who are not ethnically the same as parties in Quebec. They may be Haitians, Vietnamese, from french West Africa or the Caribbean and reside primarily in Montreal. At times,the separatism movement defines parties as "pur laine" or from the ethnic Quebecois. So there is this tension between ethnic and language defined identities, and urban (Montreal) and rural (Quebec City and the countryside in Quebec). The assertion of Quebec nationalism also comes into conflict with Quebec Indians (or First Nations as referred to in Canada) as the the First Nation claim predates the French colonial claim. Despite that, I think you would find many people in Quebec to be quite accepting of other racial people, particularly younger people who have grown up in a different world where Canada is multicultural. Canadian First Nations are also very interesting in their approach to inclusion, as they typically have always added to their numbers by conquest, adoption and intermarriage. Government, more particularly the British and Canadian, introduced a blood test based on descent through the husband to maintain "Indian status", primarily to limit inclusion in the group and encourage absorption into the general culture. As Indian status became a benefit, parties would modify their conduct such as not specifying the father and remaining unmarried to maintain Indian status for their children. It is interesting that in the modern treaties or land claims agreements, the First Nations are very clear that the aas a group who define who the beneficiaries and to include parties who have been accepted into the community. Even in the more polarized relations that exist right now, most First Nation communities will still accept and be open to people who wish to participate and to know them. Environment is the last example and with the closest parallels to aliens. One direction it is going is to go away form a human centered approach, to ecosytems and othe species within the values and parties who have to be accomodated. There is even an insult about being speciest (ie human centered). Why do I mention this: It seems to me that identity, race, what is male and what is female, and what is human and what is alien is a social construct, and we can choose to accept or excluse others in these constructs. I like to define "feminism" includes all these variables. Similarly, rejection of what is different is not automatic and need not occur. The question would be how to avoid the development of the history and culture of hate discussed in books like Igantieff's The Blood of Nations. The other question that interest me is how one reconciles after that period, which is why I find the expreience of truth commissions in places like South Africa and Chile facinating. It also why I enjoy Butler's books as they seem to explore race, human and gender issues. Magdalena > -----Original Message----- > From: Feminist SF/Fantasy and Utopia Literature ON TOPIC > [mailto:FEMINISTSF-LIT@LISTSERV.UIC.EDU]On Behalf Of Jessie > Stickgold-Sarah > Sent: February 7, 2000 12:53 > To: FEMINISTSF-LIT@LISTSERV.UIC.EDU > Subject: Re: [*FSF-L*] Dawn > > > Magdalena wrote: > >However, I will still assert that in Canada there is no clear majority > >ethnic population in English speaking Canada. While some parties resent > >this, and this gives rise to racism and discrimination, to be a > Canadian is > >not to be defined ethnically, but to be defined culturally. > > I've been reading recently about the issues of immigration in Western > Europe, an area which historically has not been very immigrant-friendly. > One comment was made that anyone could become French (for example) but you > had to really *be French*. The assumption was that an immigrant would > completely embrace French culture, rather than bringing her own > culture and > adding it to the stewpot--which is, of course, the American Way. I found > that fascinating, because it had never occured to think about it that way. > One might argue that this is exactly what's happening to the humans in > Dawn: they're invited to join the Oankali, but solely on their terms. > > Jessie > ========================================================================= Date: Mon, 7 Feb 2000 18:15:26 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Nancy Phillips Subject: Re: Dawn In-Reply-To: <003a01bf71bb$d10ee2e0$2c3ca8c2@oemcomputer> MIME-version: 1.0 Content-type: text/plain; charset=us-ascii Content-transfer-encoding: 8BIT The "enemy" in this piece seems to be the Oankali. No human sees them as unalloyed saviors. Those that ally themselves with the Oankali recognise that the Oankali have incredibly effective seduction techniques once allowed access to the human body - direct manipulation of the nervous system. It doesn't stop the humans from feeling "used" sometimes. It feels like rape to them. Oankali however are neither good guys or bad guys, even though they are the enemy. As for Butler being anti-male, I don't see this in her work as a whole, though in some individual novels it is rather prominent (Doro, the immortal male vampire in Wild Seed, is a particularly repellent individual, though his nasty propensity is explained as driven by his traumatic discovery of his powers (eats his family) and a physiology that is different from the female immortal shapeshifter Anyawu (sic)). The older male doctor in the recent Parable novels is a gentle hero, as are a good many other men in the Parable novels. However, men, when they choose to be predators, are shown as more effective predators. The human male characters in the early part of Dawn aren't all that interesting, and the main focus is on Lilith vs. Oankali, esp. Nikanj. It is not such a bad thing to have a SF novel where a woman is an active first-contact participant. Even if the initial first contact was rape of a sort, she controls much fo the interaction thereafter. Would the book be a topic for the list if a human man was running the first contact and offering passive human women for alien breeding use? Men are seen as on the whole less adaptable to a situation where they are no longer in control. I would say that this is a true characterisation. The human men in the later books in the trilogy are more interesting. Several people on the list have alluded to a certain discomfort with Butler. Most of the novels make me squeamish at times. The "heros" often cut the kind of bargains for survival that are morally ambiguous. There is no knight in silver armor. Jane said: >I was getting so >irritated by her heavy-handed characterisation of the bad-guys (mainly human >males). > >I don^Òt mind two-dimensional stereotypes in their place. I can thoroughly >enjoy a fantasy epic with the forces of darkness as no more than identikit >villains, but I rapidly lose patience when a author makes it clear they are >writing a ^Ñserious^Ò book and then produces a one-side, blinkered analysis >that answers nothing. btw, I had no idea that Lisbon was 20% black during the slave trade era. 20% of permanent free inhabitants? No subsequent emigrations? (well, I am just a provincial Midwesterner) Nancy Phillips, M.D. phone:(314)577-8782 Pathology fax:(314)268-5120 St. Louis University Hospital email: phillinj@slu.edu 3635 Vista Ave. St. Louis, MO, 63110, USA aacgccaattgctatccccatattctgctaatcccgagcatggac ========================================================================= Date: Mon, 7 Feb 2000 20:15:49 -0600 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Nancy Phillips Subject: The Canada thread (was: Re: [*FSF-L*] Dawn- We are all social constructs In-Reply-To: <003a01bf71cf$f40a54f0$8546e4cf@dial.cadvision.com> MIME-version: 1.0 Content-type: text/plain; charset="us-ascii" Magdalena and others, have you read Elizabeth Vonarburg's Reluctant Voyagers? I must admit I found it a bit opaque, although intriguing. I suspect that a Quebecois/e would "get it" a bit better than an American from the midwest. It is set in a near-future Montreal with a walled and patrolled Francophone portion (ghetto, as in Jewish quarter, not "no-grocery-stores US people-of-color" ghetto), and a smaller Quebec university town, Chicoutimi. >I would like to illustrate this with an example from Canada. Quebec receives >many French language immigrants who are not ethnically the same as parties >in Quebec. They may be Haitians, Vietnamese, from french West Africa or the >Caribbean and reside primarily in Montreal. At times,the separatism movement >defines parties as "pur laine" or from the ethnic Quebecois. So there is >this tension between ethnic and language defined identities, and urban >(Montreal) and rural (Quebec City and the countryside in Quebec). The >assertion of Quebec nationalism also comes into conflict with Quebec Indians >(or First Nations as referred to in Canada) as the the First Nation claim >predates the French colonial claim. Despite that, I think you would find >many people in Quebec to be quite accepting of other racial people, >particularly younger people who have grown up in a different world where >Canada is multicultural. > Nancy Phillips, M.D. phone:(314)577-8782 Pathology fax:(314)268-5120 St. Louis University Hospital email: phillinj@slu.edu 3635 Vista Ave. St. Louis, MO, 63110, USA aacgccaattgctatccccatattctgctaatcccgagcatggac ========================================================================= Date: Mon, 7 Feb 2000 23:03:50 -0400 Reply-To: asaro@sff.net Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: Catherine Asaro Subject: Book chat MIME-Version: 1.0 Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit The SciFi channel/ Dominion site is going a chat tomorrow that ought to be a lot of fun. Here is the blurb: ====== Tuesday, February 8 at 9PM ET Join us for an online exploration of a new landscape where genres meet and greet. Science Fiction Romance is an area where the science fiction (or fantasy) genre overlaps that of romance, shadowing forth stirring works where the signal features of both types of narrative are equally important. In this chat, authors Catherine Asaro, Diane Turnshek, Jennifer Dunne, and Tom Purdom will pool their talents and field questions from far and wide about this important subgenre. This event is the latest in a series of chats with notable genre authors co-presented by Asimov's Science Fiction. Asimov's and Analog Science Fiction magazines are the leading publishers of SF short fiction today. These two premiere publications are also awash with genre laurels. Asimov's stories have won 29 Hugos and 24 Nebulas, and has received the last 10 Locus Awards for best magazine. Analog, known for its hard science fiction and cutting edge fact articles, is the longest running, almost continuously published SF magazine in the world. Connect your IRC software client to events.scifi.com and join channel #auditorium to participate. Chatters with a java-capable browser may use our java chat client. WebTV users can follow this link. ==== You can also get to the chat via: http://www.scifi.com/chat/chatnow.html?event Hope you all can come! -- Best regards Catherine Asaro http://www.sff.net/people/asaro/ -- Best regards Catherine Asaro http://www.sff.net/people/asaro/ ========================================================================= Date: Mon, 7 Feb 2000 23:02:04 -0500 Reply-To: Feminist SF/Fantasy and Utopia Literature ON TOPIC Sender: Feminist SF/Fantasy and Utopia Literature ON TOPIC From: "Janice E. Dawley" Subject: BDG: Dawn/Contact Mime-Version: 1.0 Content-Type: text/plain; charset="us-ascii" At 08:28 PM 2/6/2000 -0800, Magdalena A. K. Muir wrote: >One question the novel raised for me, and that I would like to raise for >others, is whether human beings would be so hostile to alien contact and >interaction. There seem to very strong emphasis on that instinctive >revulsion, and the use of it to justify even the murder of one's fellow >humans. I questioned this assumption as well. As others have pointed out, there are plenty of examples in real life of racial or ethnic stereotyping leading to violence and death, but they are not directly analogous to the situation in *Dawn*. Nationalism, racism, sexism are conceptual constructs that are taught to children, reinforced over time, and often directed at specific groups. It takes work to maintain them. I can believe that some of the awakened humans would be ready and willing to begin work on an anti-alien mythology when they find out the Oankali's plans, but the structure is not yet in place when they are first awakened. And not all people would necessarily buy into it. As Magdalena says, part of Butler's explanation for the uniformity of reaction is the instinctive aversion humans feel for the Oankali's creepy, otherworldly appearance. I found this vaguely plausible, though overdone (it would have been more convincing if the Oankali resembled some animal customarily feared by humans, i.e. insects or slimy creatures).* But this aversion stage eventually passes. From there on out, a mysterious "humanity first" sentiment takes over. Some are more hard-core about it than others, but the more temperate, including Lilith, are simply biding their time until they have some real hope of escape. Why are there no "traitors" who genuinely side with the Oankali and don't want to escape from them? And why aren't there more conflicts between the humans themselves? (The only things they have in common -- apart from their humanity -- are that they speak English and somehow lived through the nuclear war.) Maybe we are to assume that all of the "collaborators" have already been awakened and are living with Oankali families on the ship, but I would expect a much wider range of responses to the (nearly) all-powerful aliens. (What about cargo cults?) Jane Fletcher mentioned Gwyneth Jones's *North Wind*, and I can vouch for *White Queen*, the first book in the sequence -- it made me dizzy and definitely could use a re-read, but I came away with a powerful sense of how heartbreakingly strange things can get in the real world, let alone in a world invaded by aliens. I read fiction partly to learn how people can do and be things I've never imagined; Butler's novels leave me with a rather empty feeling on this front, though in some ways *Dawn* was a quite satisfying read. Sheryl mentioned that the Xenogenesis trilogy should be discussed as a whole, and I agree that that might help, but I also remember that my reaction to *Adulthood Rites* was much the same when I first read it, several years ago. Maybe it's due for a re-read. -- Janice "sure, take my genetic material -- as long as I don't have to carry the baby" Dawley * Nikanj explains to Lilith that all creatures fear the unknown because it might prove dangerous. We know that this isn't completely true as far as Earth creatures are concerned. Anyone remember the stories about penguins and/or seals in the polar regions walking right up to human explorers because they had never seen them before and didn't know they were dangerous? ----- Janice E. Dawley.....Burlington, VT http://homepages.together.net/~jdawley/ Listening to: Lo Fidelity Allstars -- How to Operate with a Blown Mind "...the public and the private worlds are inseparably connected; the tyrannies and servilities of the one are the tyrannies and servilities of the other." Virginia Woolf, Three Guineas